|
Principal Investigator: Kenneth W. Simpson
Contact Information: Email: kws5@cornell.edu - Phone: 607-253-3251
Sponsor: Center for Vertebrate Genomics
Grant Number:
Title: Investigation of the Genetic Basis of Histiocytic Ulcerative Colitis in the Boxer Dog
Annual Direct Cost: $15,000
Project Period: 12/01/07-11/30/08
DESCRIPTION (provided by applicant): A definitive diagnosis of HUC in affected Boxers will be established as follows:
- Exclusion of intestinal parasites, Salmonella and Campylobacter by fecal analysis and culture.
- Characteristic colonoscopic appearance of mucosal ulceration and hemorrhage
- Histological evaluation of colonic mucosal biopsies by an ACVP-boarded veterinary pathologist to confirm histiocytic inflammation and PAS+macrophages (Figures 1 and 2).
- Evaluation by FISH of formalin-fixed, paraffin-embedded sections of colon using a eubacterial probe (EUB-338, GCTGCCTCCCGTAGGAGT) and E. coli probe4 (GCAAAGGTATTAACTTTACTCCC) to document the characteristic mucosal invasion Figure 3).
Blood samples from ~20 affected Boxer dogs will be collected, and blood samples from ~20 unaffected Boxer dogs over 6 years of age with no history of gastrointestinal disease will serve as the control population. DNA will be extracted from all blood samples using a QIAamp DNA minikit (QIAGEN Inc, Valencia, CA) and DNA will be stored at 80C until processing.
Genome-wide association mapping will be used to initially identify regions of interest in affected HUC Boxers compared to non-affected Boxer dogs. This will be accomplished using the canine Affymetrix GeneChip 27,000 SNP array, according to methodology previously described.18,19 This methodology has already been successfully demonstrated to identify the single discrete region of the genome associated with 2 recessive traits, analyzing for each trait, for 10 affected animals and 10 controls.18,19 Data from previous association studies in Boxer dog will be made available to serve as additional controls for the present study, thus increasing the cost effectiveness of the current project. SNP loci with risk alleles identified in HUC affected dogs in this study will also be cross-referenced in silico against the reference boxer dog genome CANFam2.0, sequenced and assembled by the Broad Institute. Regions showing a high degree of association will then be fine-mapped to define the minimal Linkage Disequilibrium Interval (LDI) segregating in Boxer dogs, and in selected dogs from other breeds considered likely to have identical disease to Boxers. The minimal LDI will be evaluated to identify potential candidate genes.
|
